The Illumina MiSeqDx(TM) Cystic Fibrosis Clinical Sequencing Assay is a targeted sequencing in vitro diagnostic system that re-sequences the protein coding regions and intrones of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene in genomic DNA isolated from human periphers collected in K2EDTA. The test detects single nucleotide variants, and small InDels within the region sequenced, and additionally reports on two deep intronic mutations and two large deletions. The test is intended to be used on the Illumina MiSeqDx Instrument.

The test is intended to be used as an aid in the diagnosis of individuals with suspected cystic fibrosis (CF). The test is most appropriate when the patient has an atypical or non-classic presentation of CF or when other mutation panels have failed to identify both causative mutations. The results of the test are intented by a board-certified clinical molecular geneticist or equivalent and should be used in conjunction with other available information including clinical symptoms, other diagnostic tess, and family history. This test is not indicated for use for stand-alone diagnostic testing, for pre-implantation testing, carrier screening, newborn screening, or population screening.

Device Description

The Illumina MiSeqDx Cystic Fibrosis Clinical Sequencing Assay consists of library preparation and sample indexing reagents, sequencing reagents and consumables, MiSeqDx instrument and data analysis software. Testing begins with genomic DNA from a peripheral whole blood sample. The genomic DNA is processed through the library preparation steps, which specifically amplifies the intended genomic regions of each sample while also adding the indexes for sample identification. Flow cell capture sequences are also added to the amplified products. The resulting sample libraries are then transferred into a MiSeqDx reagent cartridge which contains all of the reagents required for cluster generation and sequencing (Sequencing By Synthesis). The MiSeqDx Cartridge, MiSeqDx Flow Cell, and MiSeqDx SBS Solution (PR2) are then inserted into the MiSeqDx instrument, which performs cluster generation, sequencing and data analysis.

AI/ML Overview

Here's a summary of the acceptance criteria and study details for the Illumina MiSeqDx™ Cystic Fibrosis Clinical Sequencing Assay based on the provided text:

Acceptance Criteria and Device Performance

Acceptance Criteria	Reported Device Performance
Accuracy (Overall Agreement)	>99.99%
Positive Agreement (PA) for Variants (excluding PolyTG/PolyT)	100%
Positive Agreement (PA) for Variants (including PolyTG/PolyT)	99.66%
Positive Agreement (PA) for PolyTG/PolyT variants alone	98.44%
Negative Agreement (NA) for Wild Type positions	>99.99%
Reproducibility (Overall Agreement, All Sites)	99.70%
Reproducibility (PA) for Variants (excluding PolyTG/PolyT)	99.60%
Reproducibility (PA) for Variants (including PolyTG/PolyT)	99.22%
Reproducibility (PA) for PolyTG/PolyT variants alone	97.83%
Reproducibility (NA) for Wild Type	99.70%
DNA Extraction (Call Rate & Accuracy)	>99.99% (for all 3 methods tested)
DNA Extraction (Sample First Pass Rate)	100% (for all 3 methods tested)
DNA Input (Accuracy & Call Rate)	100% (for 25 ng to 1250 ng range)
Interfering Substances (Call Rate & Reproducibility)	100%

Study Details

2. Sample Size Used for the Test Set and Data Provenance

Accuracy Study Test Set:
- Total Samples: 500
- Clinical Samples: 355 (archived, anonymized gDNA from human blood) - Country of origin not specified, but the review is by the US FDA.
- Commercial Cell Line Samples: 11 (from clinical accuracy study) + 68 (from reproducibility study) = 79
- Clinical Samples (from extraction method evaluation): 14
- Synthetic Plasmid Samples: 52
- Data Provenance: Retrospective for archived clinical samples, prospective for cell line and synthetic samples generated for the study.
Reproducibility Study Test Set:
- Total Samples: 46 distinct samples (implied from the HGVS tables, with many tested in multiple replicates). The tables show analysis for 68 samples, each tested across 3 sites, with 2 operators each doing 3 runs per site, and with some samples having multiple replicates within those runs. This results in a large number of individual tests. The text explicitly states 68 cell line samples were evaluated in the reproducibility study for accuracy data.
- Data Provenance: Prospective (generated specifically for the study). The operator details suggest this was done as part of the validation study.

3. Number of Experts Used to Establish the Ground Truth for the Test Set and Qualifications of Those Experts

The ground truth reference methods were Sanger bi-directional sequencing and validated PCR based assays.
The text does not specify the number of experts used to establish the ground truth for Sanger sequencing or the PCR assays, nor their specific qualifications. It only states these were "reference methods."

4. Adjudication Method for the Test Set

The text mentions that "All results are based on initial testing. No repeat testing was done for this study" for the accuracy study. For reproducibility, some samples had "no calls" or "miscalls" initially, and further investigation was done (e.g., misidentified variant, low level contamination, improperly prepared synthetic specimen, switched samples). However, a formal adjudication method (e.g., 2+1, 3+1) involving a specific number of experts to resolve discrepancies against the reference is not explicitly described. The determination of miscalls and no calls seems to stem from comparison with the reference methods.

5. If a Multi-Reader Multi-Case (MRMC) Comparative Effectiveness Study Was Done

No, an MRMC comparative effectiveness study involving human readers with and without AI assistance was not done. This study focuses on the standalone analytical performance (accuracy, reproducibility) of the device (an in vitro diagnostic system for genetic sequencing), not on its impact on human reader performance.

6. If a Standalone (i.e., algorithm only without human-in-the-loop performance) Was Done

Yes, a standalone performance study was done. The entire accuracy and reproducibility analysis describes the performance of the Illumina MiSeqDx Cystic Fibrosis Clinical Sequencing Assay (which includes the instrument and data analysis software) in detecting genetic variants. The results (PA, NA, OA, call rates) are indicative of the algorithm's performance compared to established reference methods (Sanger sequencing and PCR assays). The "human-in-the-loop" aspect for interpretation is mentioned in the intended use, where results are to be interpreted by a board-certified clinical molecular geneticist, but the performance metrics provided are for the device's ability to 'call' the variants.

7. The Type of Ground Truth Used

Expert Consensus (implied via Gold Standard Methods): The primary ground truth for SNVs and small InDels was Sanger bi-directional sequencing. For large deletions, two validated PCR-based assays were used, with accuracy confirmed by Sanger Sequencing. These are considered gold-standard methods in molecular diagnostics, implying an expert-established and validated ground truth.

8. The Sample Size for the Training Set

The document does not specify a training set size. As this is a performance validation document for a sequencing assay, it describes the testing of the device rather than the development or training of an AI model in the conventional sense. The "MiSeqDx instrument and data analysis software" are components, but details on their development/training are not provided in this regulatory summary.

9. How the Ground Truth for the Training Set Was Established

Since a training set is not explicitly mentioned or detailed for the device's software/algorithm development, the method for establishing its ground truth is not provided in this document. The focus is on validating the final product's performance against reference standards.

Summary

{0}------------------------------------------------

: --

K132750

510(k) Summary 1.3

The following 510(k) summary was prepared in accordance with 21 CFR 807.92.

NOV 1 9 2013

{1}------------------------------------------------

510(k) Summary

GENERAL INFORMATION

Illumina Inc. Submitted by: 5200 Illumina Way San Diego, CA 92122 858-202-4500 (phone) 858-202-4600 (fax)

Company Contact: Bryan Schneider Associate Director, Regulatory Affairs 858-255-5228 (phone) bschneider@illumina.com . :
:

: ,

Date Prepared: November 18, 2013

DEVICE IDENTIFICATION

Assay: ..... ... ... ..

Trade or Proprietary Name:

	Illumina MiSeqDx™ Cystic Fibrosis ClinicalSequencing Assay
Common Name:	Sequencing by synthesis cystic fibrosis test
Classification Name:	CFTR (cystic fibrosis transmembrane conductanceregulatory) gene mutation detection (21 CFR 866.5900,Product Code PFS)
Predicate Device:	x-TAG Cystic Fibrosis 60 Kit v2 (K083845)

{2}------------------------------------------------

DEVICE DESCRIPTION

INTENDED USE

Illumina MiSeqDx™ Cystic Fibrosis Clinical Sequencing Assay

The Illumina MiSeqDx(TM) Cystic Fibrosis Clinical Sequencing Assay is a targeted sequencing in vitro diagnostic system that re-sequences the protein coding regions and intron/exon boundaries of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene in genomic DNA isolated from human peripheral whole blood specimens collected in K2EDTA. The test detects single nucleotide variants, and small InDels within the region sequenced, and additionally reports on two deep intronic mutations and two large deletions. The test is intended to be used on the Illumina MiSeqDx Instrument.

The test is intended to be used as an aid in the diagnosis of individuals with suspected cystic fibrosis (CF). The test is most appropriate when the patient has an atypical or non-classic presentation of CF or when other mutation panels have failed to identify both causative mutations. The results of the test are intended to be interpreted by a board-certified clinical molecular geneticist or equivalent and should be used in conjunction with other available information including clinical symptoms, other diagnostic tests, and family history. This test is not indicated for use for stand-alone diagnostic purposes, fetal diagnostic testing, for preimplantation testing, carrier screening, newborn screening, or population screening. i : . . . . . . . . .

{3}------------------------------------------------

SUBSTANTIAL EQUIVALENCE

・・・・

Characteristic	Illumina	Luminex (K083845)
Assay Name	Illumina MiSeqDx Cystic FibrosisClinical Sequencing Assay	Luminex xTAG®CysticFibrosis 60 Kit v2
IntendedUse	The Illumina MiSeqDx CysticFibrosis Clinical SequencingAssay is a targeted sequencing invitro diagnostic system that re-sequences the protein codingregions and intron/exonboundaries of the Cystic FibrosisTransmembrane ConductanceRegulator (CFTR) gene ingenomic DNA isolated fromhuman peripheral whole bloodspecimens collected in K2EDTA.The test detects single nucleotidevariants, and small indels withinthe region sequenced, andadditionally reports on two deepintronic mutations and two largedeletions. The test is intended tobe used on the Illumina MiSeqDxInstrument.The test is intended to be used asan aid in the diagnosis ofindividuals with suspected cysticfibrosis (CF).This assay is mostappropriate when the patient has	The xTAG® Cystic Fibrosis 60kit v2 is a device used tosimultaneously detect andidentify a panel of mutationsand variants in the cysticfibrosis transmembraneconductance regulator(CFTR) gene in human bloodspecimens. The panelincludes mutations andvariants currentlyrecommended by theAmerican College of MedicalGenetics and AmericanCollege of Obstetricians andGynecologists(ACMG/ACOG) plus someof the world's most commonand North Americanprevalent mutations. ThexTAG Cystic Fibrosis 60 kitv2 is a qualitativegenotyping test whichprovides informationintended to be used forcarrier testing in adults of
Confidential 4
Characteristic	Illumina	Luminex (K083845)
	an atypical or non-classicpresentation of CF or when othermutation panels have failed toidentify both causative mutations.The results of the test areintended to be interpreted by aboard-certified clinical moleculargeneticist or equivalent andshould be used in conjunctionwith other available informationincluding clinical symptoms,other diagnostic tests, and familyhistory. This test is not indicatedfor use for fetal diagnostic testing,for pre-implantation testing,carrier screening, newbornscreening, or populationscreening.The test is intended to be used onthe Illumina MiSeqDx™Instrument.	reproductive age, as an aidin newborn screening, and inconfirmatory diagnostictesting in newborns andchildren.The kit is not indicated foruse in fetal diagnostic or pre-implantation testing. The kitis also not indicated forstand-alone diagnosticpurposes.
Assay type	Sequencing by synthesis test	Qualitative nucleic acidmultiplex test
VariantsDetected	Mutations and variants from theprotein coding regions andintron/exon boundaries of theCFTR gene, including two deepintronic mutations and two largedeletions.	60 CFTR mutations and 4variants (benignpolymorphisms)
Characteristic	Illumina	Luminex (K083845)
Technology	PCR-based amplification ofregions of interest that are thenhybridized to a flow cell to allowsequencing by synthesis	Multiplex PCR followed bymultiplex allele specificprimer extension forgenotyping, hybridized tomultiplex fluorescentmicroparticles, detected byflow cytometry.
Sample Type	Nucleic acid from K2EDTAanticoagulated blood	Nucleic acid from wholeblood anticoagulated witheither EDTA or citrate.
SamplePreparation	DNA extraction using validatedlaboratory method	Same
Contra-indications	This test is not indicated for usefor fetal diagnostic testing, forpre-implantation testing, carrierscreening, newborn screening, orpopulation screening.	Not indicated for fetaldiagnostic testing, for pre-implantation testing, or forstand-alone diagnosticpurposes.
AssayControls	Positive and negative controlsrequired, not supplied	Negative controls required,not supplied. Positivecontrols recommended, notsupplied.
InstrumentSystem	MiSeqDx	Luminex 100 or 200 IS

{4}------------------------------------------------

MiSeqDx Cystic Fibrosis Clinical Sequencing Assay

、

・・・・・・・・・・・・・・・・・・・

Confidential 5

: :

{5}------------------------------------------------

Image /page/5/Picture/1 description: The image contains the word "illumina" in a bold, sans-serif font. The letters are closely spaced, and the word appears to be a logo or brand name. The overall impression is clean and modern.

PERFORMANCE.CHARACTERISTICS

Accuracy

Accuracy of the Illumina MiSeqDx Cystic Fibrosis Clinical Sequencing Assay was assessed by evaluating 500 samples representing a wide variety of CFTR variants from four separate sources. The primary source of accuracy data was a clinical accuracy study conducted using a panel of 366 samples. The majority (n = 355) of

{6}------------------------------------------------

samples consisted of archived, anonymized clinical gDNA specimens isolated from human blood, the remaining 11 samples were obtained from commercially available cell line specimens.

Data from this study was supplemented with accuracy data from 68 cell line samples evaluated in the reproducibility study, 14 clinical samples from the extraction method evaluation analytical study, and 52 synthetic plasmid samples. The synthetic plasmids were designed to include the genomic context of rare variants, and contained anywhere from 1 to 10 variants within the same construct. They were linearized, diluted to genomic DNA equivalent copy numbers, and blended with human genomic DNA samples of wild type genotype at equivalent copy numbers to mimic a heterozygous sample.

For the MiSeqDx Cystic Fibrosis Clinical Sequencing Assay, a total of 5,206 positions were compared to the reference methods of Sanger bi-directional sequencing and PCR testing. The genotyping results for SNV and small InDel sites, including the PolyTG/PolyT region, were compared to Sanger bi-directional sequence analysis.

Two validated PCR based assays were used as the reference method for the two large deletions in the panel. Each duplex PCR assay made use of 2 primer sets to discriminate between wild type, heterozygous; and homozygous genotypes. One of the primer sets was designed to flank the deletion breakpoints, whereas the other amplified a region internal to the deletion. The two products were detected by size separation on an agarose gel. The PCR assays were validated using a panel of 28 samples in all (22 samples for each deletion) consisting of cell line and blood derived genomic DNA samples, and synthetic plasmids which encompassed the WT, HET and HOM genotypes for each large deletion. The PCR assays were confirmed to have 100% specificity and reproducibility for all samples tested, by evaluation of PCR products on an agarose gel. The accuracy of the PCR assays was confirmed using Sanger Sequencing and found to be 100% for all samples.

Accuracy was determined for each genotype through three statistical measures. Positive Agreement (PA) was calculated for each variant genotype by dividing the number of samples with agreeing variant calls by the total number of samples with that variant as identified by the reference methods. Negative Agreement (NA) was calculated across all wild type (WT) positions by dividing the number of concordant WT positions by the total number of WT positions as

{7}------------------------------------------------

MiSeqDx Cystic Fibrosis Clinical Sequencing Assay

illumına

defined by the reference methods. Overall Agreement (OA) was calculated across all reported positions by dividing the number of concordant WT and variant positions by the total number of reported positions as determined by the reference methods.

The MiSeqDx Cystic Fibrosis Clinical Sequencing Assay had a genotype-level PA of 99.66% including the PolyTG/PolyT variants and 100%, excluding PolyTG/PolyT variants (Table 1). The NA for all wild types was >99.99% and the OA for all WT and variants was >99.99%. The PolyTG/PolyT variant PA was 98.44%. All results are based on initial testing. No repeat testing was done for this study.

Accuracy of the PolyTG/PolyT variants is demonstrated in Table 2.

(),,一个人

" " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " " "

・・・・・・・・・・・・・・・・・・・

and the country of the capital of the county of

、『『『』『

... .. . . . . . . . . . . . . . . . . . . . . . . . . . . .

{8}------------------------------------------------

Company of the was and

		A
	All - Alle - A deller a more - comment - comments



.- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
1










.







1





A September 2017 A 1 A 2 A 2 A 2 A 2 2 A 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2




0011136


1


the us dife which and



A M A S A T W S M A M & P W B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B
1210 1

Genotype(CommonName)	cDNA namecoordinate	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)			NoCalls	Miscalls	PositiveAgreement
					ClinicalSamples	CellLineSamples	SyntheticSamples
117120141	N/A	SNV	Exon1	25	3	0	0	0	100
117120145	N/A	SNV	Exon1	3	2	0	0	0	100
M1V	c.1A>G	SNV	Exon1	0	0	1	0	0	100
CFTR dele2, 3	c.54-5940_273+10250del21kb	Del	Intron1	4	1	0	0	0	100
R31C	c.91C>T	SNV	Exon2	3	1	0	0	0	100
Q39X	c.115C>T	SNV	Exon2	0	0	1	0	0	100
E60X	c.178G>T	SNV	Exon3	6	1	0	0	0	100
P67L	c.200C>T	SNV	Exon3	1	0	1	0	0	100
R74W	c.220C>T	SNV	Exon3	0	2	0	0	0	100
R74Q	c.221G>A	SNV	Exon3	2	0	0	0	0	100
R75X	c.223C>T	SNV	Exon3	3	1	0	0	0	100
R75Q	c.224G>A	SNV	Exon3	20	1	0	0	0	100
G85E	c.254G>A	SNV	Exon3	6	2	0	0	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)						PositiveAgreement
				ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls
394delTT	c.262_263delTT	DIV	Exon3	3	1	0	0	0	100
405+1G>A	c.273+1G>A	SNV	Intron3	0	0	1	0	0	100
406-1G>A	c.274-1G>A	SNV	Exon4	4	0	0	0	0	100
E92K	c.274G>A	SNV	Exon4	0	0	1	0	0	100
E92X	c.274G>T	SNV	Exon4	0	1	1	0	0	100
Q98X	c.292C>T	SNV	Exon4	0	0	2	0	0	100
444delA	c.312delA	DIV	Exon4	0	2	0	0	0	100
457TAT>G	c.325_327delTATinsG	DIV	Exon4	0	0	1	0	0	100
D110H	c.328G>C	SNV	Exon4	1	0	1	0	0	100
R117C	c.349C>T	SNV	Exon4	4	0	0	0	0	100
R117H	c.350G>A	SNV	Exon4	17	2	0	0	0	100
Y122X	c.366T>A	SNV	Exon4	0	1	0	0	0	100
F143LfsX10	c.425delT	DIV	Exon4	0	1	0	0	0	100
574delA	c.442delA	DIV	Exon4	0	0	2	0	0	100
Q151K	c.451C>A	SNV	Exon4	1	0	0	0	0	100

{9}------------------------------------------------

{10}------------------------------------------------

	કુﻟﻤﺴﺎnS0
ﻣﻨ	0œœœ
1	S1

Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)			NoCalls	Miscalls	PositiveAgreement
621+1G>T	c.489+1G>T	SNV	Intron4	ClinicalSamples	CellLineSamples	SyntheticSamples	0	0	100
621+3A>G	c.489+3A>G	SNV	Intron4	1	0	0	0	0	100
663delT	c.531delT	DIV	Exon5	1	0	1	0	0	100
G178R	c.532G>A	SNV	Exon5	1	1	0	0	0	100
711+1G>T	c.579+1G>T	SNV	Intron5	3	1	0	0	0	100
711+3A>G	c.579+3A>G	SNV	Intron5	0	0	1	0	0	100
711+5 G->A	c.579+5G>A	SNV	Intron5	0	0	1	0	0	100
712-1 G->T	c.580-1G>T	SNV	Exon6	0	0	1	0	0	100
H199Y	c.595C>T	SNV	Exon6	0	0	1	0	0	100
P205S	c.613C>T	SNV	Exon6	1	0	1	0	0	100
L206W	c.617T>G	SNV	Exon6	8	1	0	0	0	100
A209S	c.625G>T	SNV	Exon6	0	1	0	0	0	100
Q220X	c.658C>T	SNV	Exon6	0	0	1	0	0	100
L227R	c.680T>G	SNV	Exon6	0	0	1	0	0	100
852del22	c.720_741delAGGGAGAATCATCATCACTAC	DIV	Exon6	0	0	1	0	0	100
Genotype(CommonNamecDNA name,coordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)	ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls"	Miscalls	PositiveAgreement
E279D	c.837A>T	SNV	Exon7	1	0	0	0	0	100
R297Q	c.890G>A	SNV	Exon8	2	0	0	0	0	100
1078delT	c.948delT	DIV	Exon8	1	1	0	0	0	100
L320V	c.958T>G	SNV	Exon8	1	0	0	0	0	100
G330X	c.988G>T	SNV	Exon8	1	1	0	0	0	100
R334W	c.1000C>T	SNV	Exon8	6	1	0	0	0	100
I336K	c.1007T>A	SNV	Exon8	0	1	0	0	0	100
T338I	c.1013C>T	SNV	Exon8	0	0	1	0	0	100
1154insTC	c.1022_1023insTC	DIV	Exon8	0	1	0	0	0	100
S341P	c.1021T>C	SNV	Exon8	0	0	1	0	0	100
R347H	c.1040G>A	SNV	Exon8	6	1	1	0	0	100
R347P	c.1040G>C	SNV	Exon8	3	2	0	0	0	100
R352Q	c.1055G>A	SNV	Exon8	5	0	0	0	0	100
Q359K/T360K	c.[1075C>A;1079C>A]	SNV	Exon8	0	0	1	0	0	100
1213delT	c.1081delT	DIV	Exon8	0	0	1	0	0	100
Genotype(CommonName	cDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)	ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls	PositiveAgreement
1248+1G>A	c.1116+1G>A	SNV	Intron8	0	0	1	0	0	100
1259insA	c.1127_1128insA	DIV	Exon9	0	0	2	0	0	100
W401X(c.1202G>A)	c.1202G>A	SNV	Exon9	0	0	1	0	0	100
W401X(c.1203G>A)	c.1203G>A	SNV	Exon9	0	0	1	0	0	100
1341+1G->A	c.1209+1G>A	SNV	Intron9	0	0	2	0	0	100
PolyTGPolyT	N/A	PolyTGPolyT	Intron9	369	79	52	3	4	98.60
1461ins4	c.1329_1330insAGAT	DIV	Exon10	0	0	1	0	0	100
A455E	c.1364C>A	SNV	Exon10	4	2	0	0	0	100
1525-1G->A	c.1393-1G>A	SNV	Exon11	0	0	1	0	0	100
S466X (C->A)	c.1397C>A	SNV	Exon11	0	0	1	0	0	100
S466X (C->G)	c.1397C>G	SNV	Exon11	1	0	1	0	0	100
L467P	c.1400T>C	SNV	Exon11	0	0	1	0	0	100
V470M	c.1408G>A	SNV	Exon11	311	71	0	0	0	100

ﺗ

{11}------------------------------------------------

{12}------------------------------------------------

{13}------------------------------------------------

VariantType	CFTRgeneregion(hg19)	ClinicalSamples	CellLineSamples	SyntheticSamples	PositiveAgreement
DIV	Exon11	1	0	1	100
SNV	Exon11	0	1	0	100
SNV	Exon11	1	0	0	100
SNV	Exon11	0	0	2	100
SNV	Exon11	0	0	1	100
SNV	Exon11	4	2	0	100
SNV	Exon11	7	0	0	100
DIV	Exon11	4	2	0	100
DIV	Exon11	84	29	0	100
SNV	Exon11	0	1	0	100
SNV	Exon11	1	1	0	100
DIV	Exon11	1	0	0	100
SNV	Exon11	2	0	0	100
SNV	Exon11	0	0	1	100
SNV	Exon11	3	2	0	100

{14}------------------------------------------------

	greemerPositive	100	100	00 I	00 T	00 T	100	00 I	100	100	100	100	100	100	100
	Aiscall	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	ાદ) તાલુકાઓ પૈકીના એક એવા ગુજરાત રાજ્યના	0	0	0	0	0	0	0	0	0	0	0	0	0	0
	yntheti< Samples	0	L	0	0	I	L	0	0	L	0	0	I	I	I
ositive calls (Variants	ាជាតិ (ទី)	ਟ	0	I	દ	0	ਨ	I	€	0	ਟ	0	0	0	0
	amplesClinica	9	0	P	ਹ	0	ਨ	દ	8	0	8	I	0	র ব	0
	(618) (1784) അമ്ലിക്CFTR	Exon11	ntron11	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12	Exon12
	Varian Type	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV	SNV
	DNA nam	.1584G>I	.1585-8G>	.1585-1G>/	.1624G>	:.1645A>	.1646G>	:1647T>G	:1652G>/	.1654C>	.1657C>"	:.1666A>(	c.1673T><	.1675G>A	.1679G>
	DNA name្រុកប្រចេះ សារបោះបាន សុវណ្ណបក្សត្រ សុំសុប្រជុំសូលប្រជុំស្oordinat	E528E	717-8G->	717-1G>/	G542X	S549R c.1645A>C	5549N	S549R c.1647T>G	G551D	Q552X	R553X	556V	resss	A559T	R560K

				Positive calls (Variants)
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls	PositiveAgreement
R560T	c.1679G>C	SNV	Exon12	6	1	0	0	0	100
811+1.6kb A->G	c.1679+1.6kbA>G	SNV	Intron12	0	0	1	0	0	100
1812-1 G->A	c.1680-1G>A	SNV	Exon13	1	2	0	0	0	100
A561T	c.1681G>A	SNV	Exon13	1	0	0	0	0	100
V562I	c.1684G>A	SNV	Exon13	1	0	0	0	0	100
Y569D	c.1705T>G	SNV	Exon13	0	0	1	0	0	100
P574H	c.1721C>A	SNV	Exon13	0	1	0	0	0	100
G576A	c.1727G>C	SNV	Exon13	4	1	0	0	0	100
D579G	c.1736A>G	SNV	Exon13	0	1	0	0	0	100
E585X	c.1753G>T	SNV	Exon13	0	1	0	0	0	100
1898+1G>A	c.1766+1G>A	SNV	Intron13	2	1	0	0	0	100
1898+3A>G	c.1766+3A>G	SNV	Intron13	0	1	0	0	0	100
H609R	c.1826A>G	SNV	Exon14	0	1	0	0	0	100
D614G	c.1841A>G	SNV	Exon14	0	0	2	0	0	100
R668C	c.2002C>T	SNV	Exon14	5	2	0	0	0	100

{15}------------------------------------------------

{16}------------------------------------------------

Genotype(Common Name:cDNA name coordinate)	cDNA name	Variant Type	CFTR gene region (hg19)	Positive calls (Variants)Clinical Samples	Positive calls (Variants)Cell Line Samples	Positive calls (Variants)Synthetic Samples	No Calls	Miscalls	Positive Agreement
R668H	c.2003G>A	SNV	Exon14	1	0	0	0	0	100
2143delT	c.2012delT	DIV	Exon14	2	1	0	0	0	100
K684TfsX4	c.2046_2047delAA	DIV	Exon14	0	0	1	0	0	100
2183AA>G	c.2051_2052delAAinsG	DIV	Exon14	3	1	0	0	0	100
2184delA	c.2052delA	DIV	Exon14	1	1	0	0	0	100
2184insA	c.2052_2053insA	DIV	Exon14	3	0	1	0	0	100
S686Y	c.2057C>A	SNV	Exon14	0	1	0	0	0	100
R709X	c.2125C>T	SNV	Exon14	1	0	2	0	0	100
K710X	c.2128A>T	SNV	Exon14	3	0	0	0	0	100
E725K	c.2173G>A	SNV	Exon14	2	0	0	0	0	100
2307insA	c.2175_2176insA	DIV	Exon14	3	0	2	0	0	100
L732X	c.2195T>G	SNV	Exon14	0	0	2	0	0	100
2347delG	c.2215delG	DIV	Exon14	0	0	2	0	0	100
P750L	c.2249C>T	SNV	Exon14	1	0	0	0	0	100
V754M	c.2260G>A	SNV	Exon14	2	1	0	0	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)					PositiveAgreement
				ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls
R764X	c.2290C>T	SNV	Exon14	1	0	2	0	0	100
2585delT	c.2453delT	DIV	Exon14	0	0	2	0	0	100
E822X	c.2464G>T	SNV	Exon14	0	0	2	0	0	100
2622+1G>A	c.2490+1G>T	SNV	Intron14	0	0	2	0	0	100
E831X	c.2491G>T	SNV	Exon15	0	0	1	0	0	100
D836Y	c.2506G>T	SNV	Exon15	0	1	0	0	0	100
W846X	c.2537G>A	SNV	Exon15	0	1	0	0	0	100
R851X	c.2551C>T	SNV	Exon15	0	0	1	0	0	100
T854T	c.2562T>G	SNV	Exon15	212	44	0	0	0	100
2711delT	c.2583delT	DIV	Exon15	0	0	1	0	0	100
V868V	c.2604A>G	SNV	Exon15	2	0	0	0	0	100
2657+2_2657+3insA	c.2657+2_2657+3insA	DIV	Intron16	0	0	1	0	0	100
2789+5G>A	c.2657+5G>A	SNV	Intron16	9	1	0	0	0	100
Q890X	c.2668C>T	SNV	Exon17	1	0	0	0	0	100
A923A	c.2769C>T	SNV	Exon17	1	0	0	0	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)			NoMiscalls	PositiveAgreement
				ClinicalSamples	CellLineSamples	SyntheticSamples
L927P	c.2780T>C	SNV	Exon17	0	0	1	0	100
S945L	c.2834C>T	SNV	Exon17	0	0	1	0	100
M952T	c.2855T>C	SNV	Exon17	1	0	0	0	100
3007delG	c.2875delG	DIV	Exon17	0	0	1	0	100
T966T	c.2898G>A	SNV	Exon17	5	0	0	0	100
G970R	c.2908G>C	SNV	Exon17	0	0	1	0	100
S977F	c.2930C>T	SNV	Exon18	0	0	1	0	100
3120G>A	c.2988G>A	SNV	Exon18	1	0	0	0	100
3120+1G>A	c.2988+1G>A	SNV	Intron18	7	1	0	0	100
3121-1G->A	c.2989-1G>A	SNV	CFSyn_Ex19	0	0	1	0	100
L997F	c.2991G>C	SNV	Exon19	2	1	0	0	100
I1027T	c.3080T>C	SNV	Exon19	1	2	0	0	100
3272-26A>G	c.3140-26A>G	SNV	Intron19	0	1	0	0	100
F1052V	c.3154T>G	SNV	Exon20	0	1	0	0	100
L1065P	c.3194T>C	SNV	Exon20	0	0	1	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)			PositiveAgreement
				ClinicalSamples	CellLineSamples	SyntheticSamples	No"Calls"	Miscalls
R1066C	c.3196C>T	SNV	Exon20	6	0	0	0	0	100
R1066H	c.3197G>A	SNV	Exon20	1	0	1	0	0	100
G1069R	c.3205G>A	SNV	Exon20	0	1	0	0	0	100
R1070W	c.3208C>T	SNV	Exon20	0	2	0	0	0	100
R1070Q	c.3209G>A	SNV	Exon20	0	1	0	0	0	100
L1077P	c.3230T>C	SNV	Exon20	0	0	1	0	0^	100
W1089X	c.3266G>A	SNV	Exon20	4	0	0	0	0	100
Y1092X (C>A)	c.3276C>A	SNV	Exon20	3	1	0	0	0	100
Y1092X (C>G)	c.3276C>G	SNV	Exon20	0	0	1	0	0	100
T1095T	c.3285A>T	SNV	Exon20	7	0	0	0	0	100
M1101K	c.3302T>A	SNV	Exon20	2	2	0	0	0	100
E1104X	c.3310G>T	SNV	Exon20	0	0	1	0	0	100
c.3368-2A>T	c.3368-2A>T	SNV	Intron20	0	1	0	0	0	100
D1152H	c.3454G>C	SNV	Exon21	10	1	0	0	0	100
V1153E	c.3458T>A	SNV	Exon21	1	0	0	0	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)					PositiveAgreement
				ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls
R1158X	c.3472C>T	SNV	Exon22	7	1	0	0	0	100
R1162X	c.3484C>T	SNV	Exon22	5	1	0	0	0	100
R1162L	c.3485G>T	SNV	Exon22	0	2	0	0	0	100
3659delC	c.3528delC	DIV	Exon22	4	1	0	0	0	100
S1196X	c.3587C>G	SNV	Exon22	1	0	0	0	0	100
W1204X(c.3611G>A)	c.3611G>A	SNV	Exon22	0	0	1	0	0	100
W1204X(c.3612G>A)	c.3612G>A	SNV	Exon22	0	0	1	0	0	100
3791delC	c.3659delC	DIV	Exon22	2	0	0	0	0	100
I1234V	c.3700A>G	SNV	Exon22	1	0	1	0	0	100
S1235R	c.3705T>G	SNV	Exon22	9	1	0	0	0	100
3849+10kbC>T	c.3717+12191C>T	SNV	Intron22	11	2	0	0	0	100
G1244E	c.3731G>A	SNV	Exon23	0	0	1	0	0	100
3876delA	c.3744delA	DIV	Exon23	6	1	0	0	0	100
S1251N	c.3752G>A	SNV	Exon23	1	0	1	0	0	100
Genotype(CommonNamecDNA namecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)
				ClinicalSamples	CellLineSamples	SyntheticSamples	NoCalls	Miscalls	PositiveAgreement
3905insT	c.3773_3774insT	DIV	Exon23	3	1	0	0	0	100
D1270N	c.3808G>A	SNV	Exon23	0	2	0	0	0	100
W1282X	c.3846G>A	SNV	Exon23	9	1	0	0	0	100
P1290P	c.3870A>G	SNV	Exon23	10	3	0	0	0	100
4005+1G->A	c.3873+1G>A	SNV	Intron23	0	0	1	0	0	100
4016insT	c.3884_3885insT	DIV	Exon24	0	0	1	0	0	100
T1299T	c.3897A>G	SNV	Exon24	3	0	0	0	0	100
N1303K	c.3909C>G	SNV	Exon24	9	1	0	0	0	100
Q1313X	c.3937C>T	SNV	Exon24	0	0	1	0	0	100
G1349D	c.4046G>A	SNV	Exon25	0	1	0	0	0	100
4209TGTT>AA	c.4077_4080delTGTTinsAA	DIV	Exon25	0	0	1	0	0	100
CFTRdele22,23	c.3964-78_4242+577del	Del	Intron24	1	0	1	0	0	100
4382delA	c.4251delA	DIV	Exon27	0	0	1	0	0	100
Y1424Y	c.4272C>T	SNV	Exon27	6	2	0	0	0	100
Genotype(CommonNamecoordinate)	cDNA name	VariantType	CFTRgeneregion(hg19)	Positive calls (Variants)		NoSyntheticSamples	Miscalls	PositiveAgreement
Q1463Q	cDNA namec.4389G>A	SNV	Exon27	ClinicalSamples150	CellLineSamples32	0	0	100
	Total All Variants (PA)†			2072		3	4	99.66
	Total All WT (NA)				2600928	1	2**	>99.99
	Total All WT and Variants (OA)				2603000	4	6	>99.99

{17}------------------------------------------------

illumina*

.…"

{18}------------------------------------------------

・・

{19}------------------------------------------------

•

20 Confidential

. + T

{20}------------------------------------------------

{21}------------------------------------------------

{22}------------------------------------------------

amples were not retested

nowever indicated that the variant was in fact homozygous and incorrectly reported. MiSeqDx reported the variant as The Sanger report listed the P205S variant as heterozygous for the clinical sample. A review of the Sanger trac omozygous.

One of the discordant results was from the reproducibility study. The PolyTG/PolyT result for the sampl ncordant across all 18 replicates, but discordant with Sanger bi-directional sequencing.

The original synthetic heterozygous specimen was determined to be improperly prepared. When it was subsequen ested after it was re-prepared, using the same plasmid, it would be detected

ole, Sanger synthetic sample heterozygous for exon 8 was reported as heterozygous for the variant CFTR dele22, 23. Fur nvestigation revealed that this result was likely from low level contamination. Additionally, for a second samply ners could not fully detect the variant Q1463Q due to indels both upstream and downstream of the variant PA excluding PolyTG/PolyT calls was 100%

{23}------------------------------------------------

PolyTGPolyT Genotype	# Clinical Samples	# Cell Line Samples	# Synthetic Samples	# Miscalls	# No Calls^	% Accuracy
(TG)9(T)7/(TG)11(T)7	2	0	0	0	1	50.00
(TG)9(T)9/(TG)10(T)7	1	0	0	0	0	100
(TG)9(T)9/(TG)11(T)7	5	1	0	0	0	100
(TG)9(T)9/(TG)11(T)9	1	0	0	0	0	100
(TG)10(T)7/(TG)10(T)7	25	8	0	0	0	100
(TG)10(T)7/(TG)10(T)9	39	16	0	0	0	100
GPolyT Genotype	# Clinical Samples	# Cell Line Samples	# Synthetic Samples	# Miscalls	# No Calls^	% Accuracy
10(T)9/(TG)12(T)7	13	0	0	0	1	92.31
11(T)5/(TG)11(T)7	6	0	0	1	0	83.33
11(T)7/(TG)11(T)7	52	8	0	0	0	100
11(T)7/(TG)11(T)9*	2	1	0	3	0	0
11(T)7/(TG)12(T)5	2	0	0	0	0	100
11(T)7/(TG)12(T)7	37	3	0	0	0	100
11(T)9/(TG)12(T)7	3	0	0	0	0	100
12(T)7/(TG)12(T)7	2	2	0	0	0	100
Total		448		4	3	98.44

, "

. ..

: .

: : : :

・・

e 2: PolyTG/PolyT variant accuracy for the MiSeqDx Cystic Fibrosis Clinical Sequencing A

←

onfidentia

ব্য

90.91

G)10(T)7/(TG)12(T)

100

G)10(T)9/(TG)10(T)

100

ഹ

G)10(T)9/(TG)11(T

100

G)10(T)9/(TG)11(T)

100

ಳ

G)10(T)9/(TG)11(T)

100

ਟ

ಕ

G)10(T)9/(TG)12(T

100

โ

"G)10(T)7/(TG)12(T)

100

ਟ

S)10(T)7/(TG)11(T

100

と

G)10(T)7/(TG)11(T

{24}------------------------------------------------

amples were not reteste

*One of the discordant results was from the reproducibility study. The PolyT result for the sample
was concordant across all 18 replicates, but discordant with Sanger bi-dire

{25}------------------------------------------------

Reproducibili

o oreators at each it for a total one one on the parel contand a mix of genomic DNA
iphoblastoid cell lines with the CFTT gene a well as ome leukory on energer on and order he reproductibility of the MiSeqDx Cystic Fibrosis Clinical Sequencing Assay was determined through a blir
sing 3 trial sites and 2 operators at each site. Two well characte

nple pass rate, defined as the number of samples passing QC metrics on the first attempt, was 99.7%. All result ed on initial testir he genotype-level PA for all variants including the PolyTwas 99.22% and excluding the PolyTG/PolyT v
ras 99.60%. The NA for all WT was 99.70% and the OA for all reported pos A was 97.83%

{26}------------------------------------------------

MiSeqDx Cystic Fibrosis Clinical Sequencing Assay

illumina:

Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results		Agreeing Calls				Total #(All Sites)		%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls	Miscalls
1	c.1408G>A	V470M	6	18	6	6	6	0	0	100
1	c.1646G>A	S549N	6	18	6	6	6	0	0	100
1	c.2562T>G	T854T	6	18	6	6	6	0	0	100
2	c.1408G>A	V470M	6	18	6	6	6	0	0	100
2	c.1581A>G	E527E	6	18	6	6	6	0	0	100
2	c.1680-1G>A	1812-1 G>A	6	18	6	6	6	0	0	100
2	c.2562T>G	T854T	6	18	6	6	6	0	0	100
2	c.312delA	444delA	6	18	6	6	6	0	0	100
2	c.3870A>G	P1290P	6	18	6	5	6	0	1	94.44
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls"	Total #(All Sites)Miscalls	%Agreement
					Site 1	Site 2	Site 3
2	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
3	c.1408G>A	V470M	6	18	6	6	6	0	0	100
3	c.1477C>T	Q493X	6	18	6	6	6	0	0	100
3	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
3	c.2562T>G	T854T	6	18	6	6	6	0	0	100
3	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
4	c.1408G>A	V470M	6	18	5	6	6	1	0	94.44
4	c.1521_1523delCTT	F508del	6	18	5	6	6	1	0	94.44
4	c.2052delA	2184delA	6	18	5	6	6	1	0	94.44
5	c.1408G>A	V470M	6	18	6	5	6	1"	0	94.44
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAllSites	Agreeing Calls			Total #(All Sites)NoCalls	Total #(All Sites)Miscalls	Total #(All Sites)%Agreement
					Site 1	Site 2	Site 3
5	c.224G>A	R75Q	6	18	6	5	6	11	0	94.44
5	c.2562T>G	T854T	6	18	6	5	6	11	0	94.44
5	c.3472C>T	R1158X	6	18	6	5	6	11	0	94.44
5	c.366T>A	Y122X	6	18	6	5	6	11	0	94.44
5	c.625G>T	A209S	6	18	6	5	6	11	0	94.44
6	c.1408G>A	V470M	6	18	6	6	6	0	0	100
6	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
6	c.2051_2052delAAinsG	2183AA>G	6	18	6	6	6	0	0	100
7	c.1408G>A	V470M	6	18	6	6	6	0	0	100
7	c.223C>T	R75X	6	18	6	6	6	0	0	100
%	greemer	100	100	100	100	100	100	100	100	100	94.44
(All SitesTotal #	Miscalls	0	0	0	0	0	0	0	0	0	i I
	CallsªNo	0	0	0	0	0	0	0	0	0	0
	Site 3	9	9	9	9	9	9	9	9	9	9
greeing Call	Site 2	9-	9	9	9	9	9	9	9	9	g
	Site 1	9	9	9	9	9	9	9	9	9	9
otal Results	SitesAll	18	81	18	81	81	81	81	81	18	81
	Per Site	!9	9	9	9	9	9	9	9	9	9
Iutation	Name	1854T	V470M	507del	F508de	T854T	Q1463Q	V470M	F508de	T854T	V1282X
GVS Name	cation if no HGV:	2562T>G	c.1408G>	519_1521delAT	1521_1523delCT	.2562T>G	.4389G>/	c.1408G>	1521_1523delC	2562T>G	3846G>
Sample		1	8	8	8	8	8	6	б	6	б
	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls			Total #(All Sites)		%Agreement
ample			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls	Miscalls
9	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
10	c.1408G>A	V470M	6	18	6	6	6	0	0	100
10	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
10	c.2562T>G	T854T	6	18	6	6	6	0	0	100
10	c.3140-26A>G	3272-26A>G	6	18	6	5	6	0	1'	94.44
10	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
11, 39	c.1408G>A	V470M	12	36	12	12	12	0	0	100
11, 39	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
11, 39	c.2002C>T	R668C	12	36	12	12	12	0	0	100
11, 39	c.2562T>G	T854T	12	36	12	12	12	0	0	100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls			Total #(All Sites)			%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls	Miscalls
11, 39	c.3717+12191C>T	3849+10kbC>T	12	36	12	12	12	0	0	100
11, 39	c.4389G>A	Q1463Q	12	36	12	12	12	0	0	100
12, 40	c.1408G>A	V470M	12	36	12	12	12	0	0	100
12, 40	c.2562T>G	T854T	12	36	12	12	12	0	0	100
12, 40	c.2988+1G>A	3120+1G>A	12	36	12	12	12	0	0	100
12, 40	c.4389G>A	Q1463Q	12	36	12	12	12	0	0	100
12, 40	c.489+1G>T	621+1G>T	12	36	12	12	12	0	0	100
13	c.1408G>A	V470M	6	18	6	6	6	0	0	100
13	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
13	c.178G>T	E60X	6	18	6	6	6	0	0	100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls			Total #(All Sites)		%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls"	Miscalls
13	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
14	c.1408G>A	V470M	6	18	6	6	6	0	0	100
14	c.1584G>A	E528E	6	18	6	6	6	0	0	100
14	c.2562T>G	T854T	6	18	6	6	6	0	0	100
14	c.3302T>A	M1101K	6	18	6	6	6	0	0	100
15	c.1408G>A	V470M	6	18	6	6	6	0	0	100
15	c.1584G>A	E528E	6	18	6	6	6	0	0	100
15	c.2562T>G	T854T	6	18	6	6	6	0	0	100
15	c.3302T>A	M1101K	6	18	6	6	6	0	0	100
16	c.1408G>A	V470M	6	18	6	6	6	0	0	100
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	Total #(All Sites)Miscalls	%Agreement
					Site 1	Site 2	Site 3
16	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
16	c.3080T>C	I1027T	6	18	6	6	6	0	0	100
17, 41	c.1408G>A	V470M	12	36	12	12	12	0	0	100
17, 41	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
17, 41	c.3528delC	3659delC	12	36	12	12	12	0	0	100
18, 42	117120145	117120145	12	36	12	12	12	0	0	100
18, 42	c.1408G>A	V470M	12	36	12	12	12	0	0	100
18, 42	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
18, 42	c.350G>A	R117H	12	36	12	12	12	0	0	100
19	c.1408G>A	V470M	6	18	6	6	6	0	0	100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results		Agreeing Calls			Total #(All Sites)			%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls	Miscalls
19	c.489+1G>T	621+1G>T	6	18	6	6	6	0	0	100
19	c.579+1G>T	711+1G>T	6	18	6	6	6	0	0	100
20, 43	c.1408G>A	V470M	12	36	12	12	12	0	0	100
20, 43	c.254G>A	G85E	12	36	12	12	12	0	0	100
20, 43	c.489+1G>T	621+1G>T	12	36	12	12	12	0	0	100
21, 44	c.1364C>A	A455E	12	36	12	12	12	0	0	100
21, 44	c.1408G>A	V470M	12	36	12	12	12	0	0	100
21, 44	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
22	c.1408G>A	V470M	6	18	6	6	6	0	0	100
22	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing CallsSite 1	Agreeing CallsSite 2	Agreeing CallsSite 3	Total #No Calls	Total #Miscalls	Total #(All Sites)% Agreement
22	c.1679G>C	R560T	6	18	6	6	6	0	0	100
22	c.2562T>G	T854T	6	18	6	6	6	0	0	100
22	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
23	c.1408G>A	V470M	6	18	6	6	6	0	0	100
23	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
23	c.3276C>A	Y1092X (C>A)	6	18	6	6	6	0	0	100
24, 45	c.1408G>A	V470M	12	36	12	12	12	0	0	100
24, 45	c.3909C>G	N1303K	12	36	12	12	12	0	0	100
24, 45	c.4046G>A	G1349D	12	36	12	12	12	0	0	100
25	c.1408G>A	V470M	6	18	6	6	6	0	0	100
									Total #
Sample	IGVS Name	lutation	otal Result			greeing Call			(All Sites	90
	ation if no HGV	Name	Per Site	SitesAll	Site 1	Site 2	Site 3	CallsªNo	Miscalls	greeme
ਤੀ	.1624G>	G542X	9	18	9	9	9	0	0	001
97	1712014	17120141	9	18	9	9	9	0	0	100
97	c.1408G>A	/470M	9	18	9	9	9	0	0	100
97	c.1624G>	G542X	9	81	9	9	9	0	0	100
27, 46	.1408G>r	/470M	टा	98	ਟਾ	टा	12	0	0	100
27, 46	c.1652G>	G551D	ਟ I	9€	ਟਾ	12	12	0	0	100
27, 46	c.1657C>1	R553X	ਟ I	98	ਟ I	ਟਾ	12	0	0	100
27, 46	2562T>G	T854T	ਟ I	96	ਟ।	ਟ L	12	0	0	100
27, 46	:4389G>A	Q1463Q	ਟ I	9€	ਟਾ	ਟਾ	12	0	0	100
87	.1408G>	/470M	9	81	9	9	9	0	0	100
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	Total #(All Sites)Miscalls	%Agreement
28	c.2562T>G	T854T	6	18	6	6	6	0	0	100
28	c.3717+12191C>T	3849+10kbC>T	6	18	6	6	6	0	0	100
28	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
29	c.1408G>A	V470M	6	18	6	6	6	0	0	100
29	c.2562T>G	T854T	6	18	6	6	6	0	0	100
29	c.91C>T	R31C	6	18	6	6	6	0	0	100
30	c.1408G>A	V470M	6	18	6	6	6	0	0	100
30	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
30	c.2562T>G	T854T	6	18	6	6	6	0	0	100
30	c.3485G>T	R1162L	6	18	6	6	6	0	0	100
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	Total #(All Sites)Miscalls	% Agreement
					Site 1	Site 2	Site 3
30	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
31	c.1408G>A	V470M	6	18	6	6	6	0	0	100
31	c.1585-1G>A	1717-1G>A	6	18	6	6	6	0	0	100
31	c.2562T>G	T854T	6	18	6	6	6	0	0	100
31	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
32	c.1408G>A	V470M	6	18	6	6	6	0	0	100
32	c.2562T>G	T854T	6	18	6	6	6	0	0	100
32	c.3484C>T	R1162X	6	18	6	6	6	0	0	100
32	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
33	c.1040G>C	R347P	6	18	6	6	6	0	0	100

27 Confidential

...
... : : . : •

{27}------------------------------------------------

{28}------------------------------------------------

{29}------------------------------------------------

. .

{30}------------------------------------------------

{31}------------------------------------------------

. Li

{32}------------------------------------------------

Confidential

{33}------------------------------------------------

Confidential

{34}------------------------------------------------

{35}------------------------------------------------

,;'

{36}------------------------------------------------

{37}------------------------------------------------

38 Confidential

:『

{38}------------------------------------------------

{39}------------------------------------------------

	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls			Total #(All Sites)		%Agreement
ample			Per Site	Site 1	Site 2	Site 3	NoCalls	Miscalls
33	c.1408G>A	V470M	6	6	6	6	0	0	100
33	c.1652G>A	G551D	6	6	6	6	0	0	100
33	c.2562T>G	T854T	6	6	6	6	0	0	100
33	c.4272C>T	Y1424Y	6	6	6	6	0	0	100
33	c.4389G>A	Q1463Q	6	6	6	6	0	0	100
34	c.1000C>T	R334W	6	6	6	6	0	0	100
34	c.3368-2A>T	c.3368-2A>T	6	6	6	6	0	0	100
35	c.1523T>G	F508C	6	6	6	6	0	0	100
36	c.254G>A	G85E	6	6	6	6	0	0	100
36	c.3454G>C	D1152H	6	6	6	6	0	0	100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	Total #(All Sites)Miscalls	%Agreement
					Site 1	Site 2	Site 3
37	c.1007T>A	I336K	6	18	6	6	6	0	0	100
37	c.1408G>A	V470M	6	18	6	6	6	0	0	100
37	c.2562T>G	T854T	6	18	6	6	6	0	0	100
37	c.3705T>G	S1235R	6	18	6	6	6	0	0	100
38	c.1408G>A	V470M	6	18	6	6	6	0	0	100
38	c.1727G>C	G576A	6	18	6	6	6	0	0	100
38	c.2002C>T	R668C	6	18	6	6	6	0	0	100
38	c.2057C>A	S686Y	6	18	6	6	6	0	0	100
38	c.2562T>G	T854T	6	18	6	6	6	0	0	100
38	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAllSites	Agreeing CallsSite 1	Agreeing CallsSite 2	Agreeing CallsSite 3	Total #(All Sites)NoCalls	Total #(All Sites)Miscalls	%Agreement
47, 85	c.1408G>A	V470M	12	36	12	12	12	0	0	100
47, 85	c.2562T>G	T854T	12	36	12	12	12	0	0	100
47, 85	c.2657+5G>A	2789+5G>A	12	36	12	12	12	0	0	100
47, 85	c.4389G>A	Q1463Q	12	36	12	12	12	0	0	100
48, 86	5940_273+10250del21kbc.54-	CFTRdele2,3	12	36	12	11	12	1	0	97.22
48, 86	c.1408G>A	V470M	12	36	12	11	12	1	0	97.22
48, 86	c.1521_1523delCTT	F508del	12	36	12	11	12	1	0	97.22
49, 87	c.1408G>A	V470M	12	36	12	12	12	0	0	100
49, 87	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)			%Agreement
					Site 1	Site 2	Site 3	No Calls	Miscalls
49, 87	c.1766+1G>A	1898+1G>A	12	36	12	12	12	0	0		100
50, 88	c.1408G>A	V470M	12	36	12	12	12	0	0		100
50, 88	c.220C>T	R74W	12	36	12	12	12	0	0		100
50, 88	c.2562T>G	T854T	12	36	12	12	12	0	0		100
50, 88	c.3808G>A	D1270N	12	36	12	12	12	0	0		100
51, 89	c.1408G>A	V470M	12	36	12	12	12	0	0		100
51, 89	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0		100
51, 89	c.2012delT	2143delT	12	36	12	12	12	0	0		100
52	c.3744delA	3876delA	6	18	6	6	6	0	0		100
53, 90	c.3773_3774insT	3905insT	12	36	12	12	12	0	0		100
Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results		Agreeing Calls			Total #(All Sites)		%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls"	Miscalls
54, 91	c.1408G>A	V470M	12	36	12	12	12	0	0	100
54, 91	c.262_263delTT	394delTT	12	36	12	12	12	0	0	100
55,92	c.1408G>A	V470M	12	36	12	12	12	0	0	100
55,92	c.1519A>G	I507V	12	36	12	12	12	0	0	100
55,92	c.1521_1523delCTT	F508del	12	36	12	12	12	0	0	100
55,92	c.2562T>G	T854T	12	36	12	12	12	0	0	100
55,92	c.3080T>C	I1027T	12	36	12	12	12	0	0	100
55,92	c.4389G>A	Q1463Q	12	36	12	12	12	0	0	100
56	c.1408G>A	V470M	6	18	6	6	6	0	0	100
56	c.2562T>G	T854T	6	18	6	6	6	0	0	100

Confidential

{40}------------------------------------------------

{41}------------------------------------------------

{42}------------------------------------------------

Confidential

{43}------------------------------------------------

{44}------------------------------------------------

HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls	Total #(All Sites)	%Agreement
		Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls	Miscalls
c.3154T>G	F1052V	6	18	6	6	6	0	0	100
c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
117120141	117120141	6	18	6	6	6	0	0	100
c.1408G>A	V470M	6	18	6	6	6	0	0	100
c.2562T>G	T854T	6	18	6	6	6	0	0	100
c.3209G>A	R1070Q	6	18	6	6	6	0	0	100
c.1408G>A	V470M	6	18	6	6	6	0	0	100
c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
c.2991G>C	L997F	6	18	6	6	6	0	0	100
c.1408G>A	V470M	6	18	6	6	6	0	0	100
	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	Total #(All Sites)Miscalls	%Agreement
Sample					Site 1	Site 2	Site 3
59	c.2562T>G	T854T	6	18	6	6	6	0	0	100
59	c.3205G>A	G1069R	6	18	6	6	6	0	0	100
60	c.1408G>A	V470M	6	18	6	6	6	0	0	100
60	c.2562T>G	T854T	6	18	6	6	6	0	0	100
60	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
60	c.617T>G	L206W	6	18	6	6	6	0	0	100
61	c.1408G>A	V470M	6	18	6	6	6	0	0	100
61	c.2260G>A	V754M	6	18	6	6	6	0	0	100
61	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
62	c.1408G>A	V470M	6	18	6	6	6	0	0	100

{45}------------------------------------------------

{46}------------------------------------------------

Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total Results Per Site	Total Results All Sites	Agreeing Calls			Total # (All Sites) No Calls	Total # (All Sites) Miscalls	% Agreement
					Site 1	Site 2	Site 3
62	c.2562T>G	T854T	6	18	6	6	6	0	0	100
62	c.988G>T	G330X	6	18	6	6	6	0	0	100
64	c.1040G>A	R347H	6	18	6	6	6	0	0	100
64	c.1408G>A	V470M	6	18	6	6	6	0	0	100
64	c.2562T>G	T854T	6	18	6	6	6	0	0	100
64	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
65	c.948delT	1078delT	6	18	6	6	6	0	0	100
66	c.1408G>A	V470M	6	18	6	6	6	0	0	100
66	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
66	c.532G>A	G178R	6	18	6	6	6	0	0	100

{47}------------------------------------------------

Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total Results Per Site	Total Results All Sites	Agreeing Calls Site 1	Agreeing Calls Site 2	Agreeing Calls Site 3	% Agreement
67	c.1408G>A	V470M	6	18	6	6	6	100
67	c.1647T>G	S549R (c.1647T>G)	6	18	6	6	6	100
68	c.1408G>A	V470M	6	18	6	6	6	100
68	c.1646G>A	S549N	6	18	6	6	6	100
68	c.2562T>G	T854T	6	18	6	6	6	100
68	c.4389G>A	Q1463Q	6	18	6	6	6	100
69	c.2506G>T	D836Y	6	18	6	6	6	100
69	c.2537G>A	W846X	6	18	6	6	6	100
70	c.1408G>A	V470M	6	18	6	6	6	100

{48}------------------------------------------------

Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls	%Agreement
70	c.2562T>G	T854T	6	18	Site 16	Site 26	Site 36	0	100
70	c.3485G>T	R1162L	6	18	6	6	6	0	100
70	c.4389G>A	Q1463Q	6	18	6	6	6	0	100
71	c.1408G>A	V470M	6	18	6	6	6	0	100
71	c.1521_1523delCTT	F508del	6	18	6	6	6	0	100
71	c.2562T>G	T854T	6	18	6	6	6	0	100
71	c.274G>T	E92X	6	18	6	6	6	0	100
71	c.4389G>A	Q1463Q	6	18	6	6	6	0	100
72	c.1022_1023insTC	1154insTC	6	18	6	6	5	1	94.44
72	c.1408G>A	V470M	6	18	6	6	5	1	94.44

Confidential

{49}------------------------------------------------

Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)		%Agreement
					Site 1	Site 2	Site 3	NoCalls	Miscalls
72	c.2562T>G	T854T	6	18	6	6	5	1	0	94.44
72	c.4389G>A	Q1463Q	6	18	6	6	5	1	0	94.44
72	c.489+1G>T	621+1G>T	6	18	6	6	5	1	0	94.44
73	c.1408G>A	V470M	6	18	6	6	6	0	0	100
73	c.1624G>T	G542X	6	18	6	6	6	0	0	100
73	c.1826A>G	H609R	6	18	6	6	6	0	0	100
74	c.1408G>A	V470M	6	18	6	6	5	0	1	94.44
74	c.1429C>T	P477S	6	18	6	6	6	0	0	100
74	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
75	c.1408G>A	V470M	6	18	6	5	6	11	0	94.44

Confidential

{50}------------------------------------------------

Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)NoCalls	Total #(All Sites)Miscalls	%Agreement
					Site 1	Site 2	Site 3
75	c.1521_1523delCTT	F508del	6	18	6	5	6	1a	0	94.44
75	c.1721C>A	P574H	6	18	6	5	6	1a	0	94.44
76	c.1408G>A	V470M	6	18	6	6	6	0	0	100
76	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
76	c.2562T>G	T854T	6	18	6	6	6	0	0	100
76	c.425delT	F143LfsX10	6	18	6	6	6	0	0	100
76	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
77	c.1364C>A	A455E	6	18	6	6	6	0	0	100
77	c.1408G>A	V470M	6	18	6	6	6	0	0	100
77	c.489+1G>T	621+1G>T	6	18	6	6	6	0	0	100

Confidential

{51}------------------------------------------------

Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls	Total #(All Sites)	%Agreement
			Per Site	Site 1	Site 2	Site 3	AllSites	NoCalls	Miscalls
78	c.1408G>A	V470M	6	6	6	6	18	0	0	100
78	c.1581A>G	E527E	6	6	6	6	18	0	0	100
78	c.1680-1G>A	1812-1 G>A	6	6	6	6	18	0	0	100
78	c.2562T>G	T854T	6	6	6	6	18	0	0	100
78	c.312delA	444delA	6	6	6	6	18	0	0	100
78	c.3870A>G	P1290P	6	6	6	6	18	0	0	100
78	c.4389G>A	Q1463Q	6	6	6	6	18	0	0	100
79	c.1408G>A	V470M	6	6	6	6	18	0	0	100
79	c.220C>T	R74W	6	6	6	6	18	0	0	100
79	c.2562T>G	T854T	6	6	6	6	18	0	0	100

Confidential

{52}------------------------------------------------

Sample	HGVS Name (orLocation if no HGVS)	MutationName	Total Results	Agreeing Calls			Total #(All Sites)			%Agreement
			Per Site	AllSites	Site 1	Site 2	Site 3	NoCalls"	Miscalls
79	c.3808G>A	D1270N	6	18	6	6	6	0	0	100
80	117120141	117120141	6	18	6	6	6	0	0	100
80	c.1408G>A	V470M	6	18	6	6	6	0	0	100
80	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
80	c.1657C>T	R553X	6	18	6	6	6	0	0	100
80	c.2562T>G	T854T	6	18	6	6	6	0	0	100
81	c.1408G>A	V470M	6	18	6	6	6	0	0	100
81	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
81	c.1652G>A	G551D	6	18	6	6	6	0	0	100
81	c.2562T>G	T854T	6	18	6	6	6	0	0	100

{53}------------------------------------------------

Sample	HGVS Name (or Location if no HGVS)	Mutation Name	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)No Calls"	Total #(All Sites)Miscalls	Total #(All Sites)% Agreement
					Site 1	Site 2	Site 3
81	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
82	c.1040G>C	R347P	6	18	6	6	6	0	0	100
82	c.1408G>A	V470M	6	18	6	6	6	0	0	100
82	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
82	c.4272C>T	Y1424Y	6	18	6	6	6	0	0	100
83	117120145	117120145	6	18	6	6	6	0	0	100
83	c.1408G>A	V470M	6	18	6	6	6	0	0	100
83	c.1521_1523delCTT	F508del	6	18	6	6	6	0	0	100
83	c.350G>A	R117H	6	18	6	6	6	0	0	100
84	c.1408G>A	V470M	6	18	6	6	6	0	0	100

{54}------------------------------------------------

	HGVS Name (orLocation if no HGVS)	MutationName	Total ResultsPer Site	Total ResultsAll Sites	Agreeing Calls			Total #(All Sites)NoCalls	Total #(All Sites)Miscalls	Total #(All Sites)%Agreement
Sample					Site 1	Site 2	Site 3
84	c.1519_1521delATC	I507del	6	18	6	6	6	0	0	100
84	c.2562T>G	T854T	6	18	6	6	6	0	0	100
84	c.4389G>A	Q1463Q	6	18	6	6	6	0	0	100
	Total All Variants (PA)* (including thePolyTGPolyT data in Table 4)		2580	7740	2562	2553	2565	37	23	99.22
	Total All WT (NA)		2871132	8613396	2865930	2855526	2865932	26006	2	99.70
	Total All WT and variants (OA)		2873712	8621136	2868492	2858079	2868497	26043	25	99.70

Samples were not retest

¶ One replicate each of samples 5 and 75 had a 0% call rate. Further investigation indicated that the samples had likely no een added to the sample plate prior to library preparation

Upon review, samples 9 and 10 were likely switched by the operator prior to library preparati

{55}------------------------------------------------

Excluding PolyTG/PolyT variants, the PA was 99.60%

...

—

{56}------------------------------------------------

SSAV
41
Seatlencing


t

Clinical Sequencing194
TOTOSIS :
11 9 8 8 8 0 8 0 8 0 8 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

99.89ﺑ1
UC
l-
ﭘ11
M1400.

CHE ITELUCULA
.
ﻟﻠﻘﺎﻧﻮﻥ ﺍﻟﻤﺴﺎﺣﺔ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘ




Kontod1101h111711111111" In VIVUHUUUIII11to the
Parcel1. In course for a
ﻟTODA
ﻟﻤﺴﺎﺣﺔ ﺍﻟﻤﺴﺎﺣﺔ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮ1

ﻟStﺎ ﺍﻟﻤﺴﺎﺣﺔ ﺍﻟﻤﺴﺎﺣﺔ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤﺴﺘﻮﻯ ﺍﻟﻤ
4.4:
Table

. ·

···

Panel	Sample	Genotype	TotalResults	Agreeing Calls			Total #(All Sites)		%Agreement
			PerSite	Sites	Site1	Site2	Site3	NoCalls	Miscalls
A	1	(TG)12(T)7/(TG)12(T)7	6	18	6	6	6	0	0	100
A	2	(TG)10(T)9/(TG)10(T)7	6	18	6	6	6	0	0	100
A	3	(TG)10(T)7/(TG)10(T)9	6	18	6	6	6	0	0	100
A	4	(TG)10(T)9/(TG)11(T)7	6	18	5	6	6	1	0	94.44
A	5	(TG)10(T)7/(TG)11(T)7	6	18	6	5	6	1	0	94.44
A	6	(TG)10(T)9/(TG)10(T)7	6	18	6	6	6	0	0	100
A	7	(TG)10(T)9/(TG)11(T)7	6	18	6	6	6	0	0	100
A	8	(TG)10(T)7/(TG)10(T)9	6	18	6	6	6	0	0	100
A	9	(TG)10(T)9/(TG)10(T)7	6	18	6	6	6	0	0	100
A	10	(TG)10(T)9/(TG)10(T)7	6	18	6	6	6	0	0	100
		TotalResults	Agreeing Calls	Total #(All Sites)
A	11, 39	(TG)10(T)9/(TG)10(T)7	12	36	12	12	12	0	0	100
A	12, 40	(TG)10(T)9/(TG)11(T)7	12	36	12	12	12	0	0	100
A	13	(TG)10(T)9/(TG)11(T)7	6	18	6	6	6	0	0	100
A	14	(TG)10(T)7/(TG)11(T)7	6	18	6	6	6	0	0	100
A	15	(TG)10(T)7/(TG)11(T)7	6	18	6	5	6	1	0	94.44
A	16	(TG)10(T)9/(TG)10(T)9	6	18	6	6	6	0	0	100
A	17, 41	(TG)10(T)9/(TG)11(T)7	12	36	12	12	12	0	0	100
A	18, 42	(TG)10(T)9/(TG)12(T)5	12	36	12	12	12	0	0	100
A	19	(TG)10(T)9/(TG)11(T)7	6	18	6	6	6	0	0	100
A	20, 43	(TG)10(T)9/(TG)11(T)7	12	36	12	12	12	0	0	100
A	21, 44	(TG)10(T)9/(TG)10(T)9	12	36	12	12	12	0	0	100
A	22	(TG)10(T)9/(TG)10(T)7	6	18	6	6	6	0	0	100

{57}------------------------------------------------

ﺮ ﺗ

··

{58}------------------------------------------------

		TotalResults	Agreeing Calls	Total #(All Sites)
A	23	(TG)10(T)9/(TG)11(T)7	6	6	0	100
A	24, 45	(TG)10(T)9/(TG)11(T)7	12	12	0	100
A	25	(TG)10(T)9/(TG)10(T)9	6	6	0	100
A	26	(TG)10(T)9/(TG)11(T)7	6	6	0	100
A	27, 46	(TG)10(T)7/(TG)11(T)7	11	12	1	97.22
A	28	(TG)10(T)7/(TG)10(T)7	6	6	0	100
A	29	(TG)10(T)7/(TG)12(T)7	4	4	0	77.77
A	30	:(TG)10(T)9/(TG)10(T)7	6	6	0	100
A	31	(TG)10(T)7/(TG)11(T)7	6	6	0	100
A	32	(TG)10(T)7/(TG)10(T)7	6	6	0	100
A	33	(TG)10(T)7/(TG)11(T)7	5	6	0	94.44
A	34	(TG)11(T)7/(TG)12(T)7	6	6	0	100

{59}------------------------------------------------

. .

	TotalResults	Agreeing Calls	Total #(All Sites)
35(TG)11(T)7/(TG)11(T)7	18	6	100
36(TG)11(T)7/(TG)11(T)7	18	6	100
37(TG)11(T)7/(TG)12(T)7	18	6	100
38(TG)10(T)7/(TG)11(T)7	18	6	100
47, 85(TG)10(T)7/(TG)10(T)7	36	12	100
48, 86(TG)10(T)9/(TG)11(T)7	36	11	94.44
49, 87(TG)10(T)9/(TG)11(T)7	36	12	100
50, 88(TG)10(T)9/(TG)11(T)7	36	12	100
51, 89(TG)10(T)9/(TG)10(T)9	36	12	100
52(TG)11(T)7/(TG)11(T)7	18	6	100
53, 90(TG)11(T)7/(TG)11(T)7	36	12	100
91, 54(TG)10(T)9/(TG)11(T)7	36	12	100

{60}------------------------------------------------

	TotalResults	Agreeing Calls	Total #(All Sites)
B	92, 55	(TG)10(T)9/(TG)10(T)7	12	12	12	0	0	100
B	56	(TG)10(T)7/(TG)10(T)9	6	6	6	0	0	100
B	57	(TG)12(T)7/(TG)12(T)7	6	6	6	0	0	100
B	58	(TG)10(T)9/(TG)10(T)9	6	6	6	0	0	100
B	59	(TG)11(T)7/(TG)12(T)7	6	5	6	1	0	94.44
B	60	(TG)9(T)9/(TG)11(T)7	6	6	6	0	0	100
B	61	(TG)10(T)9/(TG)11(T)7	6	6	6	0	0	100
B	62	(TG)10(T)7/(TG)11(T)7	6	5	6	1	0	94.44
B	63	(TG)11(T)7/(TG)11(T)7	6	6	6	0	0	100
B	64	(TG)10(T)7/(TG)11(T)7	6	5	6	1	0	94.44
B	65	(TG)11(T)7/(TG)11(T)7	6	6	6	0	0	100
B	66	(TG)10(T)9/(TG)11(T)7	6	6	6	0	0	100
		TotalResults		Agreeing Calls		Total #(All Sites)
B	67	(TG)11(T)7/(TG)11(T)7	6	6	6	0	0	100
B	68	(TG)10(T)7/(TG)11(T)7	6	6	6	0	0	100
B	69	(TG)11(T)7/(TG)11(T)7	6	6	6	0	0	100
B	70	(TG)10(T)7/(TG)10(T)7	6	6	6	0	0	100
B	71	(TG)10(T)9/(TG)11(T)7	6	6	6	0	0	100
B	72	(TG)10(T)7/(TG)10(T)9	6	5	6	5	2	88.88
B	73	(TG)10(T)9/(TG)11(T)7	6	6	6	6	0	100
B	74	(TG)10(T)9/(TG)11(T)7	6	6	6	6	0	100
B	75	(TG)10(T)7/(TG)10(T)9	6	6	5	6	1	94.44
B	76	(TG)10(T)7/(TG)10(T)9	6	6	6	6	0	100
B	77	(TG)10(T)9/(TG)10(T)9	6	6	6	6	0	100
B	78	(TG)10(T)7/(TG)10(T)9	6	5	6	6	1	94.44
	TotalResults	Agreeing Calls	Total #(All Sites)
(TG)10(T)7/(TG)11(T)7	18	6	0				100
(TG)11(T)7/(TG)11(T)9	18	0	18				0
(TG)10(T)7/(TG)10(T)9	18	6	0				100
(TG)10(T)9/(TG)11(T)7	18	6	0				100
(TG)10(T)9/(TG)12(T)5	18	6	0				100
(TG)10(T)7/(TG)10(T)7	18	6	0				100
olyT Variants (PA)	1656	537	17				97.83

... |

: .

{61}------------------------------------------------

{62}------------------------------------------------

, ·

.. -

··· . ...

・

ﺘ

{63}------------------------------------------------

DNA Extraction

Three commonly used, commercially available extraction methods representing magnetic bead extraction, alcohol precipitation and silica filter column isolation methods, were evaluated using K2EDTA anti-coagulated whole blood. A total of 14 blood samples were used during the study; two were wild type, while the remaining samples carried unique genotypes representing 9 different variants, including both common and rare variants. For the polyTG/polyT variation, samples with (T)5-9 and (TG)10-12 were included. The three DNA extraction methods were tested independently by 2 different operators who each performed 3 runs per extraction method. Each extraction was performed by each operator on different days. The DNA concentration and A260/A280 ratio of the extracted gDNA samples was determined using spectrophotometry. The total sample size for each extraction method in this study was 168 (14 samples x 2 operators/extraction method x 3 runs/operator x 2 replicates/extracted gDNA sample).

ExtractionMethod	Number ofsamples tested	CallRate	Accuracy	Sample FirstPass Rate*
AlcoholPrecipitation	168	>99.99%	>99.99%	100%
Silica FilterColumn Isolation	168	>99.99%	>99.99%	100%
Magnetic BeadExtraction	168	>99.99%	>99.99%	100%

*Percent of samples having call rate of >99% in first run.

DNA input

The DNA input range of the Illumina MiSeqDx Cystic Fibrosis Clinical Sequencing Assay was evaluated by performing a serial dilution study using 14 representative DNA samples containing 16 unique CF variants. Each sample was tested in duplicate at 9 DNA input levels ranging from 1250 ng to 1 ng (1250 ng, 500 ng, 250 ng, 100 ng, 50 ng, 25 ng, 10 ng, 5 ng, and 1 ng). For determination of accuracy, sample genotypes were compared to bidirectional Sanger sequencing

{64}------------------------------------------------

data and the deletions were compared to PCR assay. 1250 ng and 25 ng were identified as the upper and lower bound for DNA input respectively as they had ≥95% sample first pass rate with no incorrect calls (100% accuracy and call rate).

DNA inputs of 1250 ng, 250 ng, and 100 ng were further tested with 4 representative DNA samples and at least 20 replicates per DNA input level for each sample (n= 4 x 20=80 samples), while the lower bound of 25 ng was tested with 14 samples, 20 replicates for each sample (n=14 x 20=280 samples). The accuracy and sample first pass rate was 100% at all DNA input levels.

Interfering Substances

To assess the impact of interfering substances on the Illumina MiSeqDx Cystic Fibrosis System, the performance of the assay was evaluated in the presence and absence of potential interferents. Sixteen whole blood specimens having unique genotypes were included in the study. Four endogenous interfering substances (bilirubin, cholesterol, hemoglobin, and triglycerides) were tested by spiking them into blood specimens prior to DNA extraction. The concentration limits for each substance is shown in the table below. Additionally, to assess interference resulting from blood collection (short draw), EDTA was spiked into blood samples, and to assess interference resulting from sample preparation, the final wash buffer from a silica filter column isolation method was added to purified genomic DNA.

The MiSeqDx Cystic Fibrosis Clinical Sequencing Assay achieved 100% call rate for all samples tested, and 100% reproducibility in genotype calls between samples in the presence and absence of interfering substances. No interference was observed for any of the potential interferents.

To assess the impact of multiplexing index primer interference, a cross contamination study using two samples, each with unique homozygous genotypes at 4 different genomic positions, and two respective index primers was performed. NO change in variant calling was observed with contamination levels <40%. The sample genotype became heterozygous when contamination levels were ≥40%. ***

Confidential રેર

{65}------------------------------------------------

Test Substance	Concentrationtested in blood(upper limit)	Concentration tested inblood (lower limit)
Bilirubin	684 µmol/L	137 µmol/L
Cholesterol	13 mmol/L	2.6mmol/L
Hemoglobin	2g/L	0.4 g/L
EDTA	7.0 mg/mL	2.8mg/mL
Triglycerides	37 mmol/L	7.4 mmol/L

、

100 - 100 - 100 -

{66}------------------------------------------------

MiSeqDx Cystic Fibrosis Clinical Sequencing Assay

.

: : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : : :

... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ,:

. :

. . . . . . .

Confidential 67

{67}------------------------------------------------

Image /page/67/Picture/1 description: The image shows a circular seal or logo. The seal contains the words "DEPARTMENT OF HEALTH & HUMAN SERVICES USA" arranged around the perimeter of the circle. In the center of the seal is a stylized emblem featuring three curved lines or shapes, possibly representing a symbol or abstract design.

Public Health Service

Food and Drug Administration 10903 New Hampshire Avenue Document Control Center - WO66-Go(b) Silver Spring, MD 20993-00002

November 19, 2013

ILLUMINA, INC. BRYAN SCHNEIDER ASSOCIATE DIRECTOR, REGULATORY AFFAIRS 5200 ILLUMINA WAY SAN DIEGO. CA 92122

Re: K132750

Trade/Device Name: Illumina MiSeqDx Cystic Fibrosis Clinical Sequencing Assay Regulation Number: 21 CFR 866.5900 Regulation Name: Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system Regulatory Class: II Product Code: PFS Dated: August 30, 2013 Received: September 3, 2013

Dear Mr. Schneider:

We have reviewed your Section 510(k) premarket notification of intent to market the device referenced above and have determined the device is substantially equivalent (for the indications for use stated in the enclosure) to legally marketed predicate devices marketed in interstate commerce prior to May 28, 1976, the enactment date of the Medical Device Amendments, or 10 devices that have been reclassified in accordance with the provisions of the Federal Food. Drug. and Cosmetic Act (Act) that do not require approval of a premarket approval application (PMA). You may, therefore, market the device, subject to the general controls provisions of the Act. The general controls provisions of the Act include requirements for annual registration, listing of devices, good manufacturing practice, labeling, and prohibitions against misbranding and adulteration. Please note: CDRH does not evaluate information related to contract liability warranties. We remind you, however, that device labeling must be truthful and not misleading.

If your device is classified (see above) into cither class II (Special Controls) or class III (PMA). it may be subject to additional controls. Existing major regulations affecting your device can be found in the Code of Federal Regulations. Title 21. Parts 800 to 898. In addition. FDA may publish further announcements concerning your device in the Federal Register.

Please be advised that FDA 's issuance of a substantial equivalence determination does not mean that FDA has made a determination that your device complies with other requirements of the Act or any Federal statutes and regulations administered by other Federal agencies. You must comply with all the Act s requirements. including, but not limited to: registration and listing (21 CFR Part 807); labeling (21 CFR Parts 801 and 809); medical device reporting (reporting of medical device-related adverse events) (21 CFR 803); good manufacturing practice requirements as set forth in the quality systems (QS) regulation (21 CFR Part 820); and if applicable. the

{68}------------------------------------------------

Page 2-Mr. Schneider

electronic product radiation control provisions (Sections 531-542 of the Act); 21 CFR 1000-1050.

If you desire specific advice for your device on our labeling regulations (21 CFR Parts 801 and 809), please contact the Division of Small Manufacturers, International and Consumer Assistance at its toll-free number (800) 638 2041 or (301) 796-7100 or at its Internet address http://www.fda.gov/MedicalDevices/RcsourcesforYou/Industry/default.htm. Also, please note the regulation entitled, "Misbranding by reference to premarket notification" (21CFR Part 807.97). For questions regarding the reporting of adverse events under the MDR regulation (21 CFR Part 803), please go to

http://www.fda.gov/MedicalDevices/Safety/ReportaProblem/default.htm for the CDRH's Office of Surveillance and Biometrics/Division of Postmarket Surveillance.

You may obtain other general information on your responsibilities under the Act from the Division of Small Manufacturers, International and Consumer Assistance at its toll-free number (800) 638-2041 or (301) 796-7100 or at its Internet address http://www.fda.gov/MedicalDevices/ResourcesforYou/Industry/default.htm.

Sincerely yours,

Reena Philip -S

for

Maria M. Chan, Ph.D. Director Division of Immunology and Hematology Devices Office of In Vitro Diagnostics and Radiological Health Center for Devices and Radiological Health

Enclosure

{69}------------------------------------------------

DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration

Indications for Use

Form Approved: OMB No. 0910-0120 Expiration Date: December 31, 2013 See PRA Statement on last page.

510(k) Number (if known)

K132750

Device Name

Illumina MiSeqDx(TM) Cystic Fibrosis Clinical Sequencing Assay

Indications for Use (Describe)

Type of Use (Select one or both, as applicable)

Prescription Use (Part 21 CFR 801 Subpart D)

Over-The-Counter Use (21 CFR 801 Subpart C)

PLEASE DO NOT WRITE BELOW THIS LINE - CONTINUE ON A SEPARATE PAGE IF NEEDED.

FOR FDA USE ONLY

Concurrence of Center for Devices and Radiological Health (CDRH) (Signature)

November 19, 2013

Image /page/69/Picture/17 description: The image shows the name "Donna M. Roscoe" in bold, black font. The text is slightly distorted, with some pixelation and blurring, particularly around the letters. The background is plain white, providing a clear contrast to the text.

Regulation Number and Section

§ 866.5900 Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

(a)
Identification. The CFTR gene mutation detection system is a device used to simultaneously detect and identify a panel of mutations and variants in the CFTR gene. It is intended as an aid in confirmatory diagnostic testing of individuals with suspected cystic fibrosis (CF), carrier identification, and newborn screening. This device is not intended for stand-alone diagnostic purposes, prenatal diagnostic, pre-implantation, or population screening.(b)
Classification. Class II (special controls). The special control is FDA's guidance document entitled “Class II Special Controls Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this guidance document.